View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4281_low_20 (Length: 236)
Name: NF4281_low_20
Description: NF4281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4281_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 23 - 221
Target Start/End: Original strand, 9997868 - 9998066
Alignment:
| Q |
23 |
acggagatttggcatcttcgtgtcttggaagtccctttttcaaccgcttcaaggttggatgttgtacatcctcagaattgacgaatttgtcatctacaag |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9997868 |
acggagatttggcatcttcgtgtcttggaagtccctttttcaaccgcttcaaggttggatgttgtacatcctcagaattgacgaatttgtcatctacaag |
9997967 |
T |
 |
| Q |
123 |
ttgagataacacataataaaggtcacgcatactcatgaaataaaaaatcagcatatatttagcaaccgtaatcacaatataaattacataatacctatg |
221 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9997968 |
ttgagataacacataataaaggtcacacatactcatgaaataaaaaatcagcatatatttagcaaccgtaatcacaatataaattacataatacctatg |
9998066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University