View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4282-Insertion-11 (Length: 265)
Name: NF4282-Insertion-11
Description: NF4282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4282-Insertion-11 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 3 - 265
Target Start/End: Complemental strand, 11474538 - 11474276
Alignment:
| Q |
3 |
aacagtaacaacagaagatacttgataacatgtggtgcaggtgactcacagacaattgtgattggtctagcagctgattcaggatgtggaaaaagtactt |
102 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11474538 |
aacagtaacaacagaagatacctgataacatgtggagcaggtgactcacagacaattgtgattggtctagcagctgattcaggatgtggaaaaagtactt |
11474439 |
T |
 |
| Q |
103 |
tcatgagaagactcacaagtgtttttggaggtgcagcagaaccaccaaaaggtggaaatcctgactcaaacacacttatcagtgacacaaccactgtgat |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11474438 |
tcatgagaagactcacaagtgtttttggaggtgcagcagaaccaccaaaaggtggaaatcctgactcaaacacacttatcagtgacacaaccactgtgat |
11474339 |
T |
 |
| Q |
203 |
atgtttggatgattaccattctttagatagaactggtagaaaagagaaaggtgttactgcact |
265 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11474338 |
atgtttggatgattaccattctttggatagaactggtagaaaagagaaaggtgttactgcact |
11474276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University