View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4282-Insertion-19 (Length: 69)
Name: NF4282-Insertion-19
Description: NF4282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4282-Insertion-19 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 42; Significance: 0.000000000000001; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 13357746 - 13357795
Alignment:
| Q |
1 |
caatattcatgctctttccatgctttaatcattgttcaggaaaccacaat |
50 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
13357746 |
caatatttatgctctttccatgctttaatcattgttcatgaaaccacaat |
13357795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 13329310 - 13329358
Alignment:
| Q |
1 |
caatattcatgctctttccatgctttaatcattgttcaggaaaccacaa |
49 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||| |||||||||| |
|
|
| T |
13329310 |
caatattcatgctccttccatgcttaaatcattgttcatgaaaccacaa |
13329358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University