View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4282-Insertion-2 (Length: 67)
Name: NF4282-Insertion-2
Description: NF4282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4282-Insertion-2 |
 | |
|
| [»] chr1 (3 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 57; Significance: 1e-24; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 57; E-Value: 1e-24
Query Start/End: Original strand, 3 - 67
Target Start/End: Complemental strand, 9030363 - 9030300
Alignment:
| Q |
3 |
cctgacttcatgttgaatgcttcctctatgtagttttcatcaaaaccctaagttttctgacattg |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9030363 |
cctgacttcatgttgaatgcttcctctatgtagttttcatc-aaaccctaagttttctgacattg |
9030300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 8e-17
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 9047775 - 9047713
Alignment:
| Q |
1 |
aacctgacttcatgttgaatgcttcctctatgtagttttcatcaaaaccctaagttttctgaca |
64 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
9047775 |
aacctgacttcatgttgaatgctttttctatgtagttttcatc-aaaccctaagttttttgaca |
9047713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.000000000005
Query Start/End: Original strand, 3 - 58
Target Start/End: Complemental strand, 9038519 - 9038465
Alignment:
| Q |
3 |
cctgacttcatgttgaatgcttcctctatgtagttttcatcaaaaccctaagtttt |
58 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||| |||||||||||||| |
|
|
| T |
9038519 |
cctgacttcatgttgaatgctttttctatgtagtcttcatc-aaaccctaagtttt |
9038465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University