View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4282-Insertion-21 (Length: 171)
Name: NF4282-Insertion-21
Description: NF4282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4282-Insertion-21 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 2e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 2e-87
Query Start/End: Original strand, 5 - 171
Target Start/End: Original strand, 40664873 - 40665039
Alignment:
| Q |
5 |
agtgaaatcgagattctgagaaagttgaggaccaacaagttcacgaacacggtccacagctgctataacagaattatcgaaattatcaataatggaaaca |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40664873 |
agtgaaatcgagattctgagaaagttgaggaccaacaagttcacgaacacggtccacagctgctataacagaattatcgaaattatcaataatggaaaca |
40664972 |
T |
|
| Q |
105 |
gcaaaaccgccttgaagaagctgaagcaccgtgtgagtgccgatgaaaccagaaccaccggtgacca |
171 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40664973 |
gcaaaaccaccttgaagaagctgaagcaccgtgtgagtgccgatgaaaccagaaccaccggtgacca |
40665039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University