View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4282-Insertion-32 (Length: 108)
Name: NF4282-Insertion-32
Description: NF4282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4282-Insertion-32 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
| [»] scaffold0011 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 92; Significance: 3e-45; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 92; E-Value: 3e-45
Query Start/End: Original strand, 13 - 108
Target Start/End: Original strand, 270120 - 270215
Alignment:
| Q |
13 |
attatatcatatccatggattctaatgacactagctgagcttattctatcagtcttgtggtttttcaaccaagcataccgatggcgtccggtgagt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
270120 |
attatatcatatccatggattctaatgacactagctgagcttattctatcagtcttgtggtttttcaaccaagcataccgatggcggccggtgagt |
270215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 4e-17
Query Start/End: Original strand, 14 - 106
Target Start/End: Complemental strand, 17589255 - 17589163
Alignment:
| Q |
14 |
ttatatcatatccatggattctaatgacactagctgagcttattctatcagtcttgtggtttttcaaccaagcataccgatggcgtccggtga |
106 |
Q |
| |
|
|||| |||||||||||| ||||||||||| |||||||| ||||||||||| | ||||| ||||||||||||| | ||| ||||| ||||||| |
|
|
| T |
17589255 |
ttatttcatatccatggcttctaatgacattagctgagattattctatcatttatgtgggttttcaaccaagcgttccgttggcggccggtga |
17589163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 51; Significance: 1e-20; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 51; E-Value: 1e-20
Query Start/End: Original strand, 14 - 88
Target Start/End: Original strand, 11730 - 11804
Alignment:
| Q |
14 |
ttatatcatatccatggattctaatgacactagctgagcttattctatcagtcttgtggtttttcaaccaagcat |
88 |
Q |
| |
|
|||| |||||||||||| ||||||||||| |||||||| ||||||||||| | |||||||||||||||||||||| |
|
|
| T |
11730 |
ttatttcatatccatggtttctaatgacaatagctgagattattctatcatttttgtggtttttcaaccaagcat |
11804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.00000000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000004
Query Start/End: Original strand, 19 - 98
Target Start/End: Complemental strand, 16386098 - 16386019
Alignment:
| Q |
19 |
tcatatccatggattctaatgacactagctgagcttattctatcagtcttgtggtttttcaaccaagcataccgatggcg |
98 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| | ||| | ||||||||| | ||||||||| ||| ||||| |
|
|
| T |
16386098 |
tcatatccatggtttctaatgacactagctgagcttattttttcatttatgtggttttcccaccaagcattccgttggcg |
16386019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University