View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4282-Insertion-34 (Length: 139)
Name: NF4282-Insertion-34
Description: NF4282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4282-Insertion-34 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 119; Significance: 3e-61; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 119; E-Value: 3e-61
Query Start/End: Original strand, 5 - 139
Target Start/End: Complemental strand, 24123392 - 24123258
Alignment:
| Q |
5 |
atatggaaatactgaactgggcgagaaggctgctgatatgttttttaagatgggaactcagaactcaggaatgtatgtcctcttttaaatccatatgcag |
104 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24123392 |
atatggaaatactgaactgggcgaggaggctgctgagatggtttttaagatgggacctcagaactcaggaatgtatgtcctcttttaaatccatatgcag |
24123293 |
T |
|
| Q |
105 |
cttcaggcagatgggtctatgctgatgagatgatg |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
24123292 |
cttcaggcagatgggtctatgctgatgagatgatg |
24123258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 95; Significance: 7e-47; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 95; E-Value: 7e-47
Query Start/End: Original strand, 7 - 137
Target Start/End: Original strand, 45169786 - 45169916
Alignment:
| Q |
7 |
atggaaatactgaactgggcgagaaggctgctgatatgttttttaagatgggaactcagaactcaggaatgtatgtcctcttttaaatccatatgcagct |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| | |||||||||||||||||| |||||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
45169786 |
atggcaatactgaactgggcgagaaggctgctcaaatgttttttaagatgggacctcagaactcaggaatgtatgtcctcttttcaatctatatgcagct |
45169885 |
T |
|
| Q |
107 |
tcaggcagatgggtctatgctgatgagatga |
137 |
Q |
| |
|
| |||||| ||||||||||||||||||||| |
|
|
| T |
45169886 |
ttgggcagacgggtctatgctgatgagatga |
45169916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 68; E-Value: 9e-31
Query Start/End: Original strand, 7 - 137
Target Start/End: Original strand, 45166960 - 45167091
Alignment:
| Q |
7 |
atggaaatactgaactgggcgagaaggctgctgatatgttttttaagatgggaactcagaactcaggaatgtatgtcc-tcttttaaatccatatgcagc |
105 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||| |||||||||||| | |||||||||| |||||||| |||| ||||| ||||| ||||||||| |
|
|
| T |
45166960 |
atggcaatactgaactgggcgagaaggctgctgagatggtttttaagatggaacctcagaactcgggaatgtacgtccttctttcaaatctatatgcagc |
45167059 |
T |
|
| Q |
106 |
ttcaggcagatgggtctatgctgatgagatga |
137 |
Q |
| |
|
|| ||||||||||| |||||||| |||||| |
|
|
| T |
45167060 |
ctcgggcagatgggttgatgctgataagatga |
45167091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University