View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4282-Insertion-36 (Length: 65)
Name: NF4282-Insertion-36
Description: NF4282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4282-Insertion-36 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 59; Significance: 9e-26; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 59; E-Value: 9e-26
Query Start/End: Original strand, 6 - 64
Target Start/End: Complemental strand, 24142375 - 24142317
Alignment:
| Q |
6 |
cagataacatcaaaaggacctcgaagaacgagttttgggtggcagtgaattatcctttt |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24142375 |
cagataacatcaaaaggacctcgaagaacgagttttgggtggcagtgaattatcctttt |
24142317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 1e-18
Query Start/End: Original strand, 6 - 64
Target Start/End: Complemental strand, 24153947 - 24153889
Alignment:
| Q |
6 |
cagataacatcaaaaggacctcgaagaacgagttttgggtggcagtgaattatcctttt |
64 |
Q |
| |
|
|||||||||||| ||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
24153947 |
cagataacatcagaaggaactcgaggaacgagttttgggtggcagtgaattatcctttt |
24153889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University