View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4282-Insertion-4 (Length: 153)
Name: NF4282-Insertion-4
Description: NF4282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4282-Insertion-4 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 117; Significance: 6e-60; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 6e-60
Query Start/End: Original strand, 1 - 153
Target Start/End: Original strand, 28300001 - 28300149
Alignment:
| Q |
1 |
gctttacctggtgaattttcagaaagattatgctgttaatctctctaagttcgtcgaaacggagatttgtaaggatgattatgtatatcctcctgcgcat |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28300001 |
gctttacctggtgaattt-cagaaagattatgctgttaatctctctaagttcgtcgaaactgagatttgtaaggatgattatgtatatcctcctgcgca- |
28300098 |
T |
|
| Q |
101 |
tttgatttttcaatgctcttaatactacccctttttcaatctgctaaggttgt |
153 |
Q |
| |
|
||||| ||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28300099 |
tttga-ttttcaatgctcttaatactacccc-ttttcaatctgctaaggttgt |
28300149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 83 - 135
Target Start/End: Original strand, 28289305 - 28289355
Alignment:
| Q |
83 |
gtatatcctcctgcgcattttgatttttcaatgctcttaatactacccctttt |
135 |
Q |
| |
|
|||||||||||| ||||||| |||||| |||||||||||||||||| |||||| |
|
|
| T |
28289305 |
gtatatcctccttcgcattt-gatttt-caatgctcttaatactactcctttt |
28289355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University