View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4282-Insertion-49 (Length: 185)
Name: NF4282-Insertion-49
Description: NF4282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4282-Insertion-49 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 7e-91; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 7e-91
Query Start/End: Original strand, 4 - 184
Target Start/End: Original strand, 32091843 - 32092023
Alignment:
| Q |
4 |
tttccatccttctggcttgtctggccaccttgaatagtctctttgtctaattgggtatgaaaaatatgtcactagttctctccaatcttttacagcttct |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
32091843 |
tttccatccttctggcttgtctggccaccttgaatagtctctttgtctaattgggtatgaaaaatatgtcactagctctctccaatctttaacagcttct |
32091942 |
T |
|
| Q |
104 |
ccctgaaaaataaaagttagtatagtgattcaaaatcttctttttcgaaaaccatattcccaaattaaatcgcgtatattt |
184 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32091943 |
ccctgaaaaataaaagttagtacagtgattcaaaatcttctttttcgaaaaccatattcccaaattaaatcgcgtatattt |
32092023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 4 - 69
Target Start/End: Original strand, 32068512 - 32068577
Alignment:
| Q |
4 |
tttccatccttctggcttgtctggccaccttgaatagtctctttgtctaattgggtatgaaaaata |
69 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
32068512 |
tttccatccttctggcttgtttggccaccttgaatagtctctttgtttaattggatatgaaaaata |
32068577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 59; Significance: 3e-25; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 4 - 90
Target Start/End: Original strand, 23310104 - 23310190
Alignment:
| Q |
4 |
tttccatccttctggcttgtctggccaccttgaatagtctctttgtctaattgggtatgaaaaatatgtcactagttctctccaatc |
90 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||| |||||||||||||||||| ||| ||| ||| ||||||||||| |
|
|
| T |
23310104 |
tttccatccttctggcttgtttggccaccttgaataatctctttctctaattgggtatgaaaagtatatcattagctctctccaatc |
23310190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 12 - 92
Target Start/End: Complemental strand, 8624235 - 8624155
Alignment:
| Q |
12 |
cttctggcttgtctggccaccttgaatagtctctttgtctaattgggtatgaaaaatatgtcactagttctctccaatctt |
92 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||| | | ||||||| |||||||||||| | || | |||||||||||||| |
|
|
| T |
8624235 |
cttctggtttgtctggccaccttgaataatctctgtctttaattggatatgaaaaatatattaccatttctctccaatctt |
8624155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University