View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4282-Insertion-5 (Length: 83)
Name: NF4282-Insertion-5
Description: NF4282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4282-Insertion-5 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 61; Significance: 8e-27; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 61; E-Value: 8e-27
Query Start/End: Original strand, 8 - 83
Target Start/End: Original strand, 38452168 - 38452244
Alignment:
| Q |
8 |
cgaaaatatttcaatatcccatcccatcacatcaaaatattactacttctt-aaaacaatgtaataaagaagaagaa |
83 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38452168 |
cgaaaatattttaatatctcatcccatcacatcaaaatattactacttcttaaaaacaatgtaataaagaagaagaa |
38452244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 4e-22
Query Start/End: Original strand, 13 - 83
Target Start/End: Complemental strand, 38170736 - 38170664
Alignment:
| Q |
13 |
atatttcaatatcccatccc-atcacatcaaaatattactacttctt-aaaacaatgtaataaagaagaagaa |
83 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
38170736 |
atatttcaatatcccatccccatcacatcaaaatattactacttcttaaaaacaatgtaatgaagaagaagaa |
38170664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University