View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4282-Insertion-6 (Length: 93)
Name: NF4282-Insertion-6
Description: NF4282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4282-Insertion-6 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 66; Significance: 9e-30; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 66; E-Value: 9e-30
Query Start/End: Original strand, 4 - 93
Target Start/End: Original strand, 38932614 - 38932701
Alignment:
| Q |
4 |
atcgatgctatctaagttggcacgactcaatttgatgacgtggtggaagctgtcgtgcttgaacataagaagagtaacaaacaaagtgtg |
93 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
38932614 |
atcgatgctatcta-gttggcacgactcactttgatgacgtggtggaagctgtcgtgc-tgaacagaagaagagtaacaaacaaagtgtg |
38932701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University