View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4282-Insertion-8 (Length: 42)
Name: NF4282-Insertion-8
Description: NF4282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4282-Insertion-8 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 30; Significance: 0.000000009; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.000000009
Query Start/End: Original strand, 9 - 42
Target Start/End: Original strand, 28386686 - 28386719
Alignment:
| Q |
9 |
tgtgggaacgttacactgaaatgtatccaaatga |
42 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
28386686 |
tgtgggaacgttacactgatatgtatccaaatga |
28386719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.000000009
Query Start/End: Original strand, 9 - 38
Target Start/End: Original strand, 28395015 - 28395044
Alignment:
| Q |
9 |
tgtgggaacgttacactgaaatgtatccaa |
38 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
28395015 |
tgtgggaacgttacactgaaatgtatccaa |
28395044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University