View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4282_high_14 (Length: 258)

Name: NF4282_high_14
Description: NF4282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4282_high_14
NF4282_high_14
[»] chr3 (1 HSPs)
chr3 (18-112)||(30203447-30203541)


Alignment Details
Target: chr3 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 18 - 112
Target Start/End: Original strand, 30203447 - 30203541
Alignment:
18 agtttgctatattcattttctaattggaggtctaataatgttttccataagcttgtctttgtttatctatggacaccatggaaaacaatcatcta 112  Q
    ||||||||| ||| ||||||||||||||| | |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
30203447 agtttgctacatttattttctaattggagttttaataatgttttccataagcttgtctttgtttgtctatggacaccatggaaaacaatcatcta 30203541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University