View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4282_high_19 (Length: 203)
Name: NF4282_high_19
Description: NF4282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4282_high_19 |
 |  |
|
| [»] scaffold0157 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0157 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: scaffold0157
Description:
Target: scaffold0157; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 35 - 187
Target Start/End: Complemental strand, 17974 - 17821
Alignment:
| Q |
35 |
tagagataagataacaaaaattacacattgtaaatctcaaaaatgaaaagtacgtacattaatatcttagaattataattttttctctatttatc-ttcg |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| || | |
|
|
| T |
17974 |
tagagataagataacaaaaattacacattgtaaatctcaaaaatgaaaagtacgtacgttaatatcttagaattataatttgttctctatttatcttttg |
17875 |
T |
 |
| Q |
134 |
tattttaaaagctttgtagaatttcttatatttacaacaatatcataaagttat |
187 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
17874 |
tattttaaaaactttgtagaatttcttatatttacaacaatatcaaaaatttat |
17821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 35 - 187
Target Start/End: Original strand, 12502503 - 12502656
Alignment:
| Q |
35 |
tagagataagataacaaaaattacacattgtaaatctcaaaaatgaaaagtacgtacattaatatcttagaattataattttttctctatttatc-ttcg |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| || | |
|
|
| T |
12502503 |
tagagataagataacaaaaattacacattgtaaatctcaaaaatgaaaagtacgtacgttaatatcttagaattataatttgttctctatttatcttttg |
12502602 |
T |
 |
| Q |
134 |
tattttaaaagctttgtagaatttcttatatttacaacaatatcataaagttat |
187 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
12502603 |
tattttaaaaactttgtagaatttcttatatttacaacaatatcaaaaatttat |
12502656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University