View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4282_low_24 (Length: 238)
Name: NF4282_low_24
Description: NF4282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4282_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 37357413 - 37357632
Alignment:
| Q |
1 |
taaaagtggctttccaagcaaagtttgcacgacgcatgctcatttttcttattttgactataatttgataagtttcttcccaataaggtgtgatcttccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
37357413 |
taaaagtggctttccaagcaaagtttgcacgacgtatgctcatttttcttattttgactataaattgataagtttcttcccaataaggtgtgatcttccc |
37357512 |
T |
 |
| Q |
101 |
ctatgtgttttatgactacttatgagtgtttgatcatcctcttaaaattatctttggttaacgccattgctgtatcttttgcagttccttgtttgataat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37357513 |
ctatgtgttttatgactacttatgagtgtttgatcatcctcttaaaattatctttggttaacgccattgttgtatcttttgcagttccttgtttgataat |
37357612 |
T |
 |
| Q |
201 |
ggcttccctcagggcggcat |
220 |
Q |
| |
|
||||||||||||| |||||| |
|
|
| T |
37357613 |
ggcttccctcaggtcggcat |
37357632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University