View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4282_low_25 (Length: 237)
Name: NF4282_low_25
Description: NF4282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4282_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 12 - 216
Target Start/End: Original strand, 48691464 - 48691667
Alignment:
| Q |
12 |
agtgagatgaaggttaactattttgtgcaagaaaaaccggggtggtgttttccactaaaatatgacattattttctttaacttttaccnnnnnnnnnnnn |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48691464 |
agtgagatgaaggttaactattttgtgcaagaaaaaccggagtggtgttttccactaaaatatgacattattttctttaacttttacc------tatata |
48691557 |
T |
 |
| Q |
112 |
ntttctgtcnnnnnnnntaaacaa-----tatatttttcaatattaagccgatagtatagatttgagcagagctccctccctcagtcacctaggtggtag |
206 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
48691558 |
ttttctgtcaaaaaaaataaacaatacagtatatttttcaatattaagctgatagtatagatttgagcagagctccctccctcagttacctaggtggtag |
48691657 |
T |
 |
| Q |
207 |
gtaatacctg |
216 |
Q |
| |
|
|||||||||| |
|
|
| T |
48691658 |
gtaatacctg |
48691667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University