View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4283-Insertion-14 (Length: 61)
Name: NF4283-Insertion-14
Description: NF4283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4283-Insertion-14 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 61; Significance: 5e-27; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 61; E-Value: 5e-27
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 55383208 - 55383148
Alignment:
| Q |
1 |
tgtccaccgttgttgccaaggtgtcaagacctgattggctccggaatgccgctggtttgat |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55383208 |
tgtccaccgttgttgccaaggtgtcaagacctgattggctccggaatgccgctggtttgat |
55383148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University