View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4283-Insertion-17 (Length: 156)
Name: NF4283-Insertion-17
Description: NF4283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4283-Insertion-17 |
 | |
|
| [»] chr4 (4 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 7e-72; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 7e-72
Query Start/End: Original strand, 9 - 156
Target Start/End: Original strand, 28300000 - 28300148
Alignment:
| Q |
9 |
agctttacctggtgaatttcagaaagattatgctgttaatctctctaagttcgtcgaaacggagatttgtaaggatgattatgtatatcctcctgcgcat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28300000 |
agctttacctggtgaatttcagaaagattatgctgttaatctctctaagttcgtcgaaactgagatttgtaaggatgattatgtatatcctcctgcgcat |
28300099 |
T |
|
| Q |
109 |
ttgattttcaatgctcttaatactacccc-tttcaatctgctaaggttg |
156 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
28300100 |
ttgattttcaatgctcttaatactaccccttttcaatctgctaaggttg |
28300148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 91 - 140
Target Start/End: Original strand, 28289305 - 28289354
Alignment:
| Q |
91 |
gtatatcctcctgcgcatttgattttcaatgctcttaatactaccccttt |
140 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28289305 |
gtatatcctccttcgcatttgattttcaatgctcttaatactactccttt |
28289354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 90 - 140
Target Start/End: Original strand, 28278407 - 28278457
Alignment:
| Q |
90 |
tgtatatcctcctgcgcatttgattttcaatgctcttaatactaccccttt |
140 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28278407 |
tgtaaatcctcctcagcatttgattttcaatgctcttaatactactccttt |
28278457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 85 - 140
Target Start/End: Original strand, 28281188 - 28281243
Alignment:
| Q |
85 |
gattatgtatatcctcctgcgcatttgattttcaatgctcttaatactaccccttt |
140 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||| ||||| |||| ||||| ||||| |
|
|
| T |
28281188 |
gattctgtatatcctcctccgcatttgattttcgatgcttttaacactactccttt |
28281243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University