View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4283-Insertion-22 (Length: 248)
Name: NF4283-Insertion-22
Description: NF4283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4283-Insertion-22 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 2 - 248
Target Start/End: Complemental strand, 49110760 - 49110514
Alignment:
| Q |
2 |
atgtctactaggcaagttccaagaagttcaaagtttttaccacagtaaaaatcagaatcaaaaataacatcagttgcagcaggaatttgaagtgccatta |
101 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
49110760 |
atgtctaataggcaagttccaagaagttcaaagtttttaccacagtaaaaatcagaatcaaaagtaacatcagttgcagcaggaatttgaagtgccatta |
49110661 |
T |
 |
| Q |
102 |
gtccatttcccacaagctcttgtgctcttgcatgcaagaaaatttccatgtctttttgatactgatttgcataagcatctacaacttccttcggagcatt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49110660 |
gtccatttcccacaagctcttgtgctcttgcatgcaagaaaatttccatgtctttttgatactgatttgcataagcatctacaacttccttcggagcatt |
49110561 |
T |
 |
| Q |
202 |
tgtgtaatgaattctccctttgttccaagcagcagaacttctgtctg |
248 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
49110560 |
tgtgtaatgaattctccctttgttacaagcagcagaacttctgtctg |
49110514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University