View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4283-Insertion-9 (Length: 103)
Name: NF4283-Insertion-9
Description: NF4283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4283-Insertion-9 |
 | |
|
| [»] chr7 (3 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 91; Significance: 1e-44; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 91; E-Value: 1e-44
Query Start/End: Original strand, 1 - 103
Target Start/End: Complemental strand, 27813300 - 27813198
Alignment:
| Q |
1 |
catctctcaagtagacataacaattgaatatgatgcaacttatatttctgccactcaaacttgaagcatacttcaaaaattgagtcattttttggcttga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27813300 |
catctctcaagtagacataacaattgaatattatacaacttatatttccgccactcaaacttgaagcatacttcaaaaattgagtcattttttggcttga |
27813201 |
T |
|
| Q |
101 |
atg |
103 |
Q |
| |
|
||| |
|
|
| T |
27813200 |
atg |
27813198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 76; E-Value: 1e-35
Query Start/End: Original strand, 1 - 100
Target Start/End: Complemental strand, 27805849 - 27805750
Alignment:
| Q |
1 |
catctctcaagtagacataacaattgaatatgatgcaacttatatttctgccactcaaacttgaagcatacttcaaaaattgagtcattttttggcttga |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||| | |||||||||||||| ||||||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
27805849 |
catcactcaagtagacataacaattgaatattacgcaacttatatttccgccactcaaacttgaagcatacttcaagaattgcgtcattttttggcttga |
27805750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 28551645 - 28551733
Alignment:
| Q |
1 |
catctctcaagtagacataacaattgaatatgatgcaacttatatttctgccactcaaacttgaagcatacttcaaaaattgagtcatt |
89 |
Q |
| |
|
||||||| || |||||| || |||| ||||| | ||||||||| ||| ||||||||||||| ||||||||| || |||||||||||| |
|
|
| T |
28551645 |
catctcttaaatagacacaataattaaatattacgcaacttatgttttcaccactcaaacttgtagcatactttaagaattgagtcatt |
28551733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University