View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4283_high_10 (Length: 262)
Name: NF4283_high_10
Description: NF4283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4283_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 6 - 169
Target Start/End: Complemental strand, 31406426 - 31406263
Alignment:
| Q |
6 |
attatgggcaggttgatgtgactctctatgagcttttttgtcattaatatgaatgaatgtgtttgccaactccttgcatttctttctcctccactaatat |
105 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31406426 |
attatgggcaggttgatgtgactctgtatgagcttttttgtcattaatatgaatgaatgtgtttgccaactccttgcatttctttctcctccactaatat |
31406327 |
T |
 |
| Q |
106 |
ttatgattgttttttaatgaaaagggaatactattaaggggacagaattcccccaatcctccca |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31406326 |
ttatgattgttttttaatgaaaagggaatactattaaggggacagaattcccccaatcctccca |
31406263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 167 - 255
Target Start/End: Complemental strand, 31405891 - 31405803
Alignment:
| Q |
167 |
ccaactggatatttctgcatcttagatagggtttcctactattttcctctatactagcacttgatcaaggacttcacatttggtctgtg |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31405891 |
ccaactggatatttctgcatcttagatagggtttcctactattttcctctatactagcacttgatcaaggccttcacatttggtctgtg |
31405803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University