View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4283_high_12 (Length: 237)
Name: NF4283_high_12
Description: NF4283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4283_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 15 - 230
Target Start/End: Original strand, 2667885 - 2668107
Alignment:
| Q |
15 |
tctctttattatcctaataatggaatgtgtaatgattcgccgcctctatagacattgtgttctttgaacttttcttcatgacccaagtcttgaagacgga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| || |
|
|
| T |
2667885 |
tctctttattatcctaataatggaatgtgtaatgattcgccgcctctatagacattgtgttctttgaacttttcttcatgacccaagttctgaagactga |
2667984 |
T |
 |
| Q |
115 |
a----atccttccttaattaccaaatgaaattgcgtgacgtatatggtgctaactgctaagtcaattttcgaccatgttc---tattttttgcgtatgtc |
207 |
Q |
| |
|
| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
2667985 |
agtctttccttccttaattaccaaatgaaattgcgtaacgtatatggtgctaactgctaagtcaattttcgaccatgttctgtttttttttgcgtatgtt |
2668084 |
T |
 |
| Q |
208 |
ttctagaactactagaattatct |
230 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
2668085 |
ttctagaactactagaattatct |
2668107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University