View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4283_low_17 (Length: 222)
Name: NF4283_low_17
Description: NF4283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4283_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 54 - 173
Target Start/End: Complemental strand, 49030095 - 49029976
Alignment:
| Q |
54 |
tttcacgaatgtctcatgcgccatattttgacatgcccaaataaacacgaatcattaagttaagtagtagttttcagtaattgcttagactaaatgacat |
153 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
49030095 |
tttcacgaatgtctcatgagccatattttgacatgcccaaataaacacgaatcattaagttaagcagtagttttctgtaattgcttagactaaatgacat |
49029996 |
T |
 |
| Q |
154 |
tttgtttatctaatctaaca |
173 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
49029995 |
tttgtttatctaatctaaca |
49029976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 47
Target Start/End: Complemental strand, 49030172 - 49030142
Alignment:
| Q |
17 |
gaaccacctctagccttatttagtttcgtaa |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
49030172 |
gaaccacctctagccttatttagtttcgtaa |
49030142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University