View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4284-Insertion-1 (Length: 185)
Name: NF4284-Insertion-1
Description: NF4284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4284-Insertion-1 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 6 - 185
Target Start/End: Original strand, 28267088 - 28267266
Alignment:
| Q |
6 |
gtaaacccagtacttttttgccacaaagaagactgatattgtattggtgcataaaaaacagtctacgcttttgtatggtgaatcactgaataatttgaag |
105 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28267088 |
gtaaacccagtacttttt-gccataaagaagactgatattgtattggtgcataaaaaacagtctacgcttttgtatggtgaatcactgaataatttgaag |
28267186 |
T |
 |
| Q |
106 |
cttacaacttgaaatctattttcattatcatgtcttgttaactaattattggtacggttatctttttacttggtgtcaag |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28267187 |
cttacaacttgaaatctattttcattatcatgtcttgttaactaattattggtacggttatctttttacttggtgtcaag |
28267266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University