View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4284-Insertion-13 (Length: 32)
Name: NF4284-Insertion-13
Description: NF4284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4284-Insertion-13 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 32; Significance: 0.0000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 32
Target Start/End: Original strand, 1699171 - 1699202
Alignment:
| Q |
1 |
tcatcatcatgctgtagctcttccatttgaag |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
1699171 |
tcatcatcatgctgtagctcttccatttgaag |
1699202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University