View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4284-Insertion-20 (Length: 142)
Name: NF4284-Insertion-20
Description: NF4284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4284-Insertion-20 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 126; Significance: 2e-65; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 126; E-Value: 2e-65
Query Start/End: Original strand, 17 - 142
Target Start/End: Complemental strand, 14817910 - 14817785
Alignment:
| Q |
17 |
acaagatacatgtgagtcgtacctcaatactaaacaaaatcaaacccaatcgatgtatatctatgtgcatatctattttagacatgaatctcgattcatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14817910 |
acaagatacatgtgagtcgtacctcaatactaaacaaaatcaaacccaatcgatgtatatctatgtgcatatctattttagacatgaatctcgattcatt |
14817811 |
T |
 |
| Q |
117 |
tatgatgagtcgcgtgaatcacagct |
142 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
14817810 |
tatgatgagtcgcgtgaatcacagct |
14817785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University