View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4284-Insertion-23 (Length: 49)
Name: NF4284-Insertion-23
Description: NF4284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4284-Insertion-23 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 44; Significance: 5e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 5e-17
Query Start/End: Original strand, 2 - 49
Target Start/End: Complemental strand, 38797176 - 38797129
Alignment:
| Q |
2 |
gaaattttgtctttatctcctgtgctttgatacgcattgagctacagg |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38797176 |
gaaattttgtctttatctcctgtgctttgatacacattgagctacagg |
38797129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University