View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4284-Insertion-7 (Length: 134)
Name: NF4284-Insertion-7
Description: NF4284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4284-Insertion-7 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 9e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 9e-65
Query Start/End: Original strand, 6 - 134
Target Start/End: Complemental strand, 1316829 - 1316701
Alignment:
| Q |
6 |
catcactcatgaaatatgtaggcaaaaccatgaactactttcatgttgcaataaatactttcctaaattactcgataaggatttggcatatagcaatgta |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1316829 |
catcactcatgaaatatgtaggcaaaaccatgaactactttcatgttgcaataaatactttcctaaattactcgattaggatttggcatatagcaatgta |
1316730 |
T |
|
| Q |
106 |
ttcaaaaccatattcctgtctgtttgaga |
134 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
1316729 |
ttcaaaaccatattcctgtctgtttgaga |
1316701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 54; Significance: 2e-22; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 2e-22
Query Start/End: Original strand, 46 - 115
Target Start/End: Complemental strand, 43486938 - 43486869
Alignment:
| Q |
46 |
tcatgttgcaataaatactttcctaaattactcgataaggatttggcatatagcaatgtattcaaaacca |
115 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
43486938 |
tcatgttgcacaaaatactttcctaaattactctattaggatttggcatatagcaatgtattcaaaacca |
43486869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University