View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4284_high_12 (Length: 237)
Name: NF4284_high_12
Description: NF4284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4284_high_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 44; Significance: 4e-16; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 27 - 113
Target Start/End: Complemental strand, 45839654 - 45839574
Alignment:
| Q |
27 |
attctaaacgatttgagttgcggcttactcttccacattattttgttctttcacacatatctatcactcttatttctttatagcaga |
113 |
Q |
| |
|
||||| || ||||||||||||| ||||||||||||||||||||| |||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
45839654 |
attcttaatgatttgagttgcgtcttactcttccacattattttattctttgacac------atcactcttatttctttatagcaga |
45839574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 182 - 219
Target Start/End: Original strand, 48889715 - 48889752
Alignment:
| Q |
182 |
aaatgagacatatgtgaagtttataacacaacagaggt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48889715 |
aaatgagacatatgtgaagtttataacacaacagaggt |
48889752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 158 - 220
Target Start/End: Complemental strand, 45839466 - 45839409
Alignment:
| Q |
158 |
tgaataagttctctgaggcaaattaaatgagacatatgtgaagtttataacacaacagaggtg |
220 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
45839466 |
tgaataagttctctgaggcaaac-----gagacatatgtgaagtttataacacacgagaggtg |
45839409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University