View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4284_high_13 (Length: 232)
Name: NF4284_high_13
Description: NF4284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4284_high_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 3 - 221
Target Start/End: Complemental strand, 24031122 - 24030904
Alignment:
| Q |
3 |
ttgtaacaaatgaaaagatgcaaaaggatgatggatcgccagagattctaatactaccttttttaataattgcaagccagttgctactccaatccgtgtg |
102 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24031122 |
ttgtaacaaatgaatagatgcaaaaggatgatggatcgccagagattctgatactaccttttttaataattgcaagccagttgctactccaatccgtgtg |
24031023 |
T |
|
| Q |
103 |
gcatctcaaccatggcgactctacaatgaagtccatgaattaagattagttttgataagaggttctcatgattagtccattatcgatgtatctttaaacc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
24031022 |
gcatctcaaccatggcgactctacaatgaagtccatcaattaagattagttctgataagaggttctcatgattagtccattatcaatgtatctttaaacc |
24030923 |
T |
|
| Q |
203 |
aagaaaatgggaaagttaa |
221 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
24030922 |
aagaaaatgggaaagttaa |
24030904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University