View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4284_low_10 (Length: 302)
Name: NF4284_low_10
Description: NF4284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4284_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 135 - 194
Target Start/End: Complemental strand, 8558649 - 8558590
Alignment:
| Q |
135 |
tgttgtgttgttgatgtaagatttccagcagcacagagtggcagaatagaatggatgttt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8558649 |
tgttgtgttgttgatgtaagatttccagcagcacagagtggcagaatagaatggatgttt |
8558590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University