View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4284_low_13 (Length: 257)
Name: NF4284_low_13
Description: NF4284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4284_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 36036164 - 36036370
Alignment:
| Q |
1 |
attttcttttcttattttttcagattcttatggacctgaaaatgatgccaaccaagatggtgttgatatgcaggcttctatatgctcttcagtttctact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36036164 |
attttcttttcttattttttcagattcttatggacctgaaaatgatgccaaccaagatggtgttgatatgcatgcttctatatgctcttcagtttctact |
36036263 |
T |
 |
| Q |
101 |
ggtaagaatttattgccc--ctttatttgttcttctgcatgttctgtatgattttttcatatattcaatttgatatattcagtctaatagcaaccacata |
198 |
Q |
| |
|
|||||||||||||||| | ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
36036264 |
ggtaagaatttattgctcatttttttttgttcttctgcatgttctgtatgattttttcatatattcaatttgatatgtttagtctaatagcaaccacata |
36036363 |
T |
 |
| Q |
199 |
aaccaag |
205 |
Q |
| |
|
||||||| |
|
|
| T |
36036364 |
aaccaag |
36036370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University