View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4284_low_15 (Length: 241)
Name: NF4284_low_15
Description: NF4284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4284_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 21 - 227
Target Start/End: Original strand, 15689891 - 15690097
Alignment:
| Q |
21 |
ggtccttctccacaagttcgtagcagatgcagaacaactcaaagtgctaaggtatttctgcatcaataggatttatttccacatcttctaatctagttag |
120 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15689891 |
ggtccttctccacaagttcgtagcaggtgcagaacaactcaaagtgctaaggtatttctgcatcaataggatttatttccacatcttctaatctagttag |
15689990 |
T |
 |
| Q |
121 |
aagtaactttgtaagtggtattccattgacaaggttagctggagataaatgtgcatcatagttatgtgacttttttgtgcccccctcaagatttggataa |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
15689991 |
aagtaactttgtaagtggtattccattgacaaggttagctggagataaatgtgcatcatagttatgtgactcttttgtgcccccctcaagatttggataa |
15690090 |
T |
 |
| Q |
221 |
ctatatt |
227 |
Q |
| |
|
||||||| |
|
|
| T |
15690091 |
ctatatt |
15690097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University