View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4284_low_20 (Length: 227)
Name: NF4284_low_20
Description: NF4284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4284_low_20 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 6 - 227
Target Start/End: Complemental strand, 14561550 - 14561327
Alignment:
| Q |
6 |
aagttgtgtct-gacattgatatcatcgccctttgatcatgtggatcatttaggactcaacattgactgctaaagttgtgtctgatgatgaatttgagag |
104 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14561550 |
aagttgtgtctagatattgatatcatcgccctttgatcatgtggaacatttaggactcaacattgactgctaaagttgtgtctgatgatgaatttgagag |
14561451 |
T |
 |
| Q |
105 |
aaatttggaagagtaaattgtggagtgttgttgaggtatttgaaatgcctaatggattgtggttgagaaatgctctcaacatggttaccgggcaatcta- |
203 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14561450 |
aaaattggaagagtaaattgtggagtgttgttgaggtatttgaaatgcctaatggattgtggttgagaaatgctctcaacatggttaccgggcaatctat |
14561351 |
T |
 |
| Q |
204 |
gacttgtaatcaaatgtagggtta |
227 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
14561350 |
gacttgtaatcaaatgtagggtta |
14561327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University