View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4284_low_21 (Length: 219)
Name: NF4284_low_21
Description: NF4284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4284_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 14 - 157
Target Start/End: Complemental strand, 28231196 - 28231055
Alignment:
| Q |
14 |
agagagaaagcggaagacatgttacctcgtttactgtggcattcgatgaggatatccctagtatgaacgtctgggaaaacaataggtctatgacaaagtt |
113 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28231196 |
agagagaaagctgaaga--tgttacctcgtttactgtggcattcgatgaggatatcccaagtatgaacgtctgggaaaacaataggtctatgacaaagtt |
28231099 |
T |
 |
| Q |
114 |
ccttgattccaaatggtttttccaattctttgattaacttcaaa |
157 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28231098 |
ccttgattccgaatggtttttccaattctttgattaacttcaaa |
28231055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University