View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4285-Insertion-11 (Length: 173)
Name: NF4285-Insertion-11
Description: NF4285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4285-Insertion-11 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 2e-87; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 2e-87
Query Start/End: Original strand, 7 - 173
Target Start/End: Original strand, 45851901 - 45852067
Alignment:
| Q |
7 |
tttttcaaattcaagtagtgttagcaaaagcaaaacccactaatctttaattcatcatacagttttgcaatgaccattttgtaactttcttgttttgtta |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45851901 |
tttttcaaattcaagtagtgttagcaaaagcaaaacccactaatctttaattcatcatacagttttgcaatgaccattttgtaactttcttgttttgtta |
45852000 |
T |
|
| Q |
107 |
atggtttaagactttttcccttgatgttatgttaattttccagaactttcagcttggacaacatgga |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45852001 |
atggtttaagactttttcccttgatgttatgttaattttccagaactttcagcttgtacaacatgga |
45852067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University