View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4285-Insertion-12 (Length: 52)
Name: NF4285-Insertion-12
Description: NF4285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4285-Insertion-12 |
 | |
|
| [»] chr2 (3 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 50; Significance: 1e-20; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 50; E-Value: 1e-20
Query Start/End: Original strand, 3 - 52
Target Start/End: Original strand, 33086258 - 33086307
Alignment:
| Q |
3 |
tcaactcatgttttcattaccaatgatttttacaaatttattttattact |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33086258 |
tcaactcatgttttcattaccaatgatttttacaaatttattttattact |
33086307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 4e-18
Query Start/End: Original strand, 3 - 52
Target Start/End: Original strand, 33046672 - 33046721
Alignment:
| Q |
3 |
tcaactcatgttttcattaccaatgatttttacaaatttattttattact |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33046672 |
tcaactcatgttttcattaccaatgatttttacaaacttattttattact |
33046721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 46; E-Value: 4e-18
Query Start/End: Original strand, 3 - 52
Target Start/End: Original strand, 33060110 - 33060159
Alignment:
| Q |
3 |
tcaactcatgttttcattaccaatgatttttacaaatttattttattact |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33060110 |
tcaactcatgttttcattaccaatgatttttacaaacttattttattact |
33060159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University