View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4285-Insertion-2 (Length: 54)
Name: NF4285-Insertion-2
Description: NF4285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4285-Insertion-2 |
 |  |
|
| [»] chr2 (5 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 54; Significance: 6e-23; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 6e-23
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 33060108 - 33060055
Alignment:
| Q |
1 |
ttttggcttcctctatgtccaagattttgttccaccatttctctatttgtgcat |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33060108 |
ttttggcttcctctatgtccaagattttgttccaccatttctctatttgtgcat |
33060055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000001
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 33046670 - 33046631
Alignment:
| Q |
1 |
ttttggcttcctctatgtccaagattttgttccaccattt |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33046670 |
ttttggcttcctctatgtccaagattttgttccaccattt |
33046631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.0000000002
Query Start/End: Original strand, 2 - 42
Target Start/End: Complemental strand, 33068230 - 33068190
Alignment:
| Q |
2 |
tttggcttcctctatgtccaagattttgttccaccatttct |
42 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33068230 |
tttggcttccttaatgtccaagattttgttccaccatttct |
33068190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.00000005
Query Start/End: Original strand, 2 - 42
Target Start/End: Complemental strand, 33076573 - 33076533
Alignment:
| Q |
2 |
tttggcttcctctatgtccaagattttgttccaccatttct |
42 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
33076573 |
tttggtttccttaatgtccaagattttgttccaccatttct |
33076533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 29; E-Value: 0.00000005
Query Start/End: Original strand, 6 - 42
Target Start/End: Complemental strand, 33086251 - 33086215
Alignment:
| Q |
6 |
gcttcctctatgtccaagattttgttccaccatttct |
42 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
33086251 |
gcttcctcaatgtccaagattttattccaccatttct |
33086215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University