View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4285-Insertion-26 (Length: 164)
Name: NF4285-Insertion-26
Description: NF4285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4285-Insertion-26 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 147; Significance: 8e-78; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 147; E-Value: 8e-78
Query Start/End: Original strand, 3 - 157
Target Start/End: Complemental strand, 34357294 - 34357140
Alignment:
| Q |
3 |
ggagagatatccaattaccagcattgccattttcttgaatgtagtgtttaagaatatcatcttcttcattagaccatggacctcttttaacttttgattt |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34357294 |
ggagagatatccaattaccagcattgccattttcttgaatgtagtgtttaagaatatcatcttcttcattagaccatggacctcttttcacttttgattt |
34357195 |
T |
|
| Q |
103 |
gtcacaacatggagccctacccatgaccttaattatttactcaacaaccctagaa |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34357194 |
gtcacaacatggagccctacccatgaccttaattatttgctcaacaaccctagaa |
34357140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 60 - 129
Target Start/End: Original strand, 4612022 - 4612091
Alignment:
| Q |
60 |
catcttcttcattagaccatggacctcttttaacttttgatttgtcacaacatggagccctacccatgac |
129 |
Q |
| |
|
||||||| ||| ||||||||| ||||| ||||||||| |||||||||||| ||||| || |||||||| |
|
|
| T |
4612022 |
catcttcatcaggagaccatggtcctctcttaactttttctttgtcacaacaaggagctcttcccatgac |
4612091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 74 - 126
Target Start/End: Complemental strand, 21173554 - 21173502
Alignment:
| Q |
74 |
gaccatggacctcttttaacttttgatttgtcacaacatggagccctacccat |
126 |
Q |
| |
|
|||||||||||||| ||||| ||| |||||||||||||||||| || ||||| |
|
|
| T |
21173554 |
gaccatggacctctcttaacacttgttttgtcacaacatggagctcttcccat |
21173502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University