View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4285-Insertion-27 (Length: 169)
Name: NF4285-Insertion-27
Description: NF4285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4285-Insertion-27 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 122; Significance: 7e-63; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 122; E-Value: 7e-63
Query Start/End: Original strand, 1 - 169
Target Start/End: Original strand, 26626874 - 26627042
Alignment:
| Q |
1 |
taattaacttccatcttcaacttctcaactaatctttaatgttaggttatttttt-acgtggatttcttgctgtaacgtaggacgtagtggtggattttg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
26626874 |
taattaacttccatcttcaacttctcaactaatctttaatgttaggttatttttttatgtggatttcttgccgtaac-taggacgtagtggtggattttg |
26626972 |
T |
 |
| Q |
100 |
atagtttaatcttaattggatgaccgagatagtttatagctcaatttttgactgcataataaaaaccatc |
169 |
Q |
| |
|
||||||| |||||||||| ||| | |||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
26626973 |
atagtttgatcttaattgaatggctgagatagtttatagctcaatttttaattgcataataaaaaccatc |
26627042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University