View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4285-Insertion-29 (Length: 142)
Name: NF4285-Insertion-29
Description: NF4285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4285-Insertion-29 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 142; Significance: 7e-75; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 142; E-Value: 7e-75
Query Start/End: Original strand, 1 - 142
Target Start/End: Original strand, 45359771 - 45359912
Alignment:
| Q |
1 |
gaggattctacagcaaaaccatgaggcaatgtggttgtggggaatgtcagtgacttgtgagttatggttttcattttcatggcttcctaagctgtgtcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45359771 |
gaggattctacagcaaaaccatgaggcaatgtggttgtggggaatgtcagtgacttgtgagttatggttttcattttcatggcttcctaagctgtgtcca |
45359870 |
T |
|
| Q |
101 |
gttactagagttactgatttgtcctattttgaaagaacagtc |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45359871 |
gttactagagttactgatttgtcctattttgaaagaacagtc |
45359912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 62; Significance: 4e-27; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 62; E-Value: 4e-27
Query Start/End: Original strand, 1 - 86
Target Start/End: Original strand, 44632704 - 44632789
Alignment:
| Q |
1 |
gaggattctacagcaaaaccatgaggcaatgtggttgtggggaatgtcagtgacttgtgagttatggttttcattttcatggcttc |
86 |
Q |
| |
|
|||||||| ||| | |||||||||||||||||||||||||| ||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
44632704 |
gaggattcgacacccaaaccatgaggcaatgtggttgtgggcaatgtcagtgacttgtgagctatggtttgcattttcatggcttc |
44632789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University