View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4285-Insertion-7 (Length: 102)
Name: NF4285-Insertion-7
Description: NF4285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4285-Insertion-7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 68; Significance: 6e-31; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 68; E-Value: 6e-31
Query Start/End: Original strand, 4 - 95
Target Start/End: Original strand, 21074967 - 21075058
Alignment:
| Q |
4 |
aatgataatgttaggttttggtatagtaaagtgtctgaactgcaattgaaaattataaaaattcattcactatatagtaaggtgatagtata |
95 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| |||| |||| |||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
21074967 |
aatgaaaatgttaggttttggtatagtaaagtgtctgaactacaatcgaaagttataaaaattccttcactatatagtaaagtgatagtata |
21075058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University