View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4285_high_16 (Length: 423)
Name: NF4285_high_16
Description: NF4285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4285_high_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 3e-89; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 3e-89
Query Start/End: Original strand, 18 - 200
Target Start/End: Original strand, 26877238 - 26877419
Alignment:
| Q |
18 |
catgtatatggggcaatgacatatgcttgatgatgaatgatgactacaccacacaaagggtcttaatcacttttgcatatagcaaagacaaaagttgtta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26877238 |
catgtatatggggcaatgacatatgcttgatgatgaatgatgactacaccacacaaagggtcttaatcacttttgcatatagcaaagacaaaagttgtta |
26877337 |
T |
 |
| Q |
118 |
atgattaagcattttatttcccaaaaagcaatgcacaatgttttgttgacatgttttaaccgttagccagggagtttctccaa |
200 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26877338 |
atgattaagcatttaattt-gcaaaaagcaatgcacaatgttttgttgacatgttttaaccgttagccagggagtttctccaa |
26877419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 325 - 423
Target Start/End: Original strand, 26877417 - 26877511
Alignment:
| Q |
325 |
caaatcatcttagagtttcataca--cttgttttatactactagtactagtatatgtgaattactttattttggaattttttatttgacaaatattttat |
422 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||||| || ||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
26877417 |
caaatcatcttagagtttcatatatacttgttttatactactagta------tacgtgaattactttattttggaattttttctttgacaaatattttat |
26877510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University