View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4285_high_53 (Length: 250)
Name: NF4285_high_53
Description: NF4285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4285_high_53 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 2 - 235
Target Start/End: Complemental strand, 23043631 - 23043398
Alignment:
| Q |
2 |
tgcttctcagcagcaaggaaaattgtggtaacagcagcaagaagcatgctccaatcaggcaactgattgatgaatgtccttgggtgatgttgtgatggtg |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23043631 |
tgcttctcagcagcaaggaaaattgtggtaacagcagcaagaagcatgctccaatcaggcaactgattgatgaatgtccttgggtgatgttgtgatggtg |
23043532 |
T |
|
| Q |
102 |
aatcattttcaaccttcaccggcgcagttgtaaccgcagttccgttgattttggaaggtgctgcatttgctttaatgtttaatccattagagcttagctt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
23043531 |
aatcattttcaaccttcaccggcgcagttgtaaccgcagttccgttgattttggaaggtgctgcatttgctttaatgtttaatccattagagctttgctt |
23043432 |
T |
|
| Q |
202 |
ggatttgtatcctccaaggttagccgaactaact |
235 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
23043431 |
ggatttgtatcctccaaggttagcagaactaact |
23043398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University