View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4285_high_56 (Length: 248)
Name: NF4285_high_56
Description: NF4285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4285_high_56 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 15 - 224
Target Start/End: Complemental strand, 28280911 - 28280685
Alignment:
| Q |
15 |
agcagagagggtggaggagccatcggttttcatgtccttggaagcatgatcaggtttggaagatgaagaagccattttctttactgttattcacaaaata |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
28280911 |
agcagagagggtggaggagccatcggttttcatgtccttggaagcatgatcaggtttggaagatgaagaagccattttctttactgttattcacaaaaca |
28280812 |
T |
 |
| Q |
115 |
aagcttgatttgaaatggtgagtgagaatgtatgtgtagcgggaatgtatgtaaagc-----------------tgagtagtaacttactcataaccgtt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28280811 |
aagcttgatttgaaatggtgagtgagaatgtatgtgtagcgggaatgtatgtaaagcatctatatataaataagtgagtagtaacttactcataaccgtt |
28280712 |
T |
 |
| Q |
198 |
tctgttagaggttttgtgacagctgtc |
224 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
28280711 |
tctgttagaggttttgtgacagctgtc |
28280685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University