View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4285_high_71 (Length: 220)

Name: NF4285_high_71
Description: NF4285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4285_high_71
NF4285_high_71
[»] chr6 (1 HSPs)
chr6 (11-198)||(30128252-30128439)


Alignment Details
Target: chr6 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 11 - 198
Target Start/End: Original strand, 30128252 - 30128439
Alignment:
11 gagtgagaagaacacaaaataaagtatatagtgatgaaaattttgtgctgggatcccgaatattgtctcttgaggtagtgtgtgccccattatccctcaa 110  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30128252 gagtgaaaagaacacaaaataaagtatatagtgatgaaaattttgtgctgggatcccgaatattgtctcttgaggtagtgtgtgccccattatccctcaa 30128351  T
111 atgtctgcgcttcttctgttgtttgctccagattctgttctggtttttcttagtcattcgatcgagcaagattgtctgaggccttgtt 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
30128352 atgtctgcgcttcttctgttgtttgctccagattctgttctggtttttcttagtcattcgaccgagcaagattgtctgaggccttgtt 30128439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University