View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4285_high_72 (Length: 220)

Name: NF4285_high_72
Description: NF4285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4285_high_72
NF4285_high_72
[»] chr1 (1 HSPs)
chr1 (19-184)||(30855319-30855483)


Alignment Details
Target: chr1 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 19 - 184
Target Start/End: Complemental strand, 30855483 - 30855319
Alignment:
19 catggaggaatgagtttttatcatctctatggttttaaattggatattcttgagaatcaatgtttggatttatccatcaaccatgataaaaaatttcaaa 118  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| | || |||||||    
30855483 catggaggaatgagtttttatcatctctatggttttaacttggatattcttgagaatcaatgtttggatttatccatcaaccatgatcagaattttcaaa 30855384  T
119 gctacatattatccaacatgagannnnnnnnggtgccaaattaggccataatctaagttttatatg 184  Q
    |||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||    
30855383 gctacatattatccaacatgaga-attttttggtgccaaattaggccataatctaagttttatatg 30855319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University