View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4285_low_33 (Length: 354)
Name: NF4285_low_33
Description: NF4285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4285_low_33 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 131; Significance: 7e-68; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 131; E-Value: 7e-68
Query Start/End: Original strand, 19 - 194
Target Start/End: Complemental strand, 14972268 - 14972105
Alignment:
| Q |
19 |
acagacgatctggaaacatggtggtgttgagggccaaacaccactcatcccaccactcatcccaccaccaatgaaaatatatcttgaaaatataaggttt |
118 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
14972268 |
acagacgatctggaaacatgatggtgttgagggccaaacaccactcatcccaccac------------caatgaaaatatatcttgaaaatataaggttt |
14972181 |
T |
 |
| Q |
119 |
aaataaaagggtgagggcggtgggtgagttcctggagagaagttagataagggtttgctgaaagaaaggggagata |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14972180 |
aaataaaagggtgagggcggtgggtgagttcctggagagaagttagataagggtttgctgaaagaaaggggagata |
14972105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 318 - 346
Target Start/End: Complemental strand, 14971978 - 14971950
Alignment:
| Q |
318 |
gttgagtcttagttatgattatgatgatg |
346 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
14971978 |
gttgagtcttagttatgattatgatgatg |
14971950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University