View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4285_low_43 (Length: 315)
Name: NF4285_low_43
Description: NF4285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4285_low_43 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 98; Significance: 3e-48; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 15 - 156
Target Start/End: Complemental strand, 21182322 - 21182181
Alignment:
| Q |
15 |
aagatcccaattagattggcacctcaaatcaaaatagacctaaggaaaatgatagataggaagaccatatctgtctctaaaaaggttaagagtttcacta |
114 |
Q |
| |
|
|||||||||| ||| |||||||||||||| |||||| ||||||||||| |||| ||||||||| ||||| |||||||||||| |||||||||||||||| |
|
|
| T |
21182322 |
aagatcccaactaggttggcacctcaaataaaaatatacctaaggaaagcgataaataggaagatcatatttgtctctaaaaaagttaagagtttcacta |
21182223 |
T |
 |
| Q |
115 |
aacaacattatctattatgtggttgtggttagcaagcttctc |
156 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
21182222 |
aacaacattatctattatgtggtcgtggttagcaagcttctc |
21182181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 169 - 254
Target Start/End: Complemental strand, 21182099 - 21182014
Alignment:
| Q |
169 |
aatacctctaatattccaaaaaggatcttcaggagtatttgtttgttcacccttggatcgtgtttataggctgacctgctaatttg |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
21182099 |
aatacctctaatattccaaaaaggatcttcaggagtatttgtttgttcacccttggatcgggtttataggctgacctgctaatttg |
21182014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University